CodExt

قم بتشفير/فك تشفير أي شيء.

CodExt هي مكتبة (متوافقة مع Python2-3) توسع المكتبة الأصلية codecs (وذلك لإضافة ترميزات وتعيينات أحرف جديدة مخصصة) وتوفر أكثر من 120 ترميزًا جديدًا، ومن هنا اسمها الذي يجمع بين تمديد الترميزات. كما أنها تتميز بـ وضع التخمين لفك تشفير طبقات متعددة من الترميز و أدوات CLI لسهولة الاستخدام.```sh $ pip install codext

هل ترغب في المساهمة في برنامج تشفير جديد؟    |     هل ترغب في المساهمة في ماكرو جديد؟
:----------------------------------:|:------------------------------------:
تحقق من [التوثيق](https://python-codext.readthedocs.io/en/latest/howto) أولاً<br>ثم [PR](https://github.com/dhondta/python-codext/pulls) لبرنامج التشفير الجديد الخاص بك | [PR](https://github.com/dhondta/python-codext/pulls) لنسختك المحدثة من [`macros.json`](https://github.com/dhondta/python-codext/blob/main/codext/macros.json)

## :mag: عروض توضيحية

<p align="center"><img src="https://assets.kitploit.com/production/public/readmes/4821/81514bb87e41cfa9d482c93830d7a2e579352988aae9b0934778095692265bde.gif" alt="استخدام CodExt من سطر الأوامر"></p>
<p align="center"><img src="https://assets.kitploit.com/production/public/readmes/4821/fa4848c3f817288ed56845964755dbb4c4a0098c76af8a6ac6e5c89f849a8d5e.gif" alt="استخدام أدوات القواعد من سطر الأوامر"></p>
<p align="center">استخدام أداة سطر الأوامر unbase</p>

## :computer: الاستخدام (أداة CLI الرئيسية) <a href="https://twitter.com/intent/tweet?text=CodExt%20-%20Encode%2Fdecode%20anything.%0D%0APython%20tool%20for%20encoding%20and%20decoding%20almost%20anything,%20including%20a%20guess%20feature%20based%20on%20AI.%0D%0Ahttps%3a%2f%2fgithub%2ecom%2fdhondta%2fpython-codext%0D%0A&hashtags=python,encodings,codecs,cryptography,morse,base,stegano,steganography,ctftools"><img src="https://img.shields.io/badge/Tweet%20(codext)--lightgrey?logo=twitter&amp;style=social" alt="Tweet on codext" height="20"/></a>```session
$ codext -i test.txt encode dna-1
GTGAGCGGGTATGTGA

$ echo -en "test" | codext encode morse
- . ... -

$ echo -en "test" | codext encode braille
⠞⠑⠎⠞

$ echo -en "test" | codext encode base100
👫👜👪👫

⛓️ تسلسل codecs```sh

$ echo -en "Test string" | codext encode reverse gnirts tseT

$ echo -en "Test string" | codext encode reverse morse --. -. .. .-. - ... / - ... . -

$ echo -en "Test string" | codext encode reverse morse dna-2 AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC

$ echo -en "Test string" | codext encode reverse morse dna-2 octal 101107124103101107124103101107124107101107101101101107124103101107124107101107101101101107124107101107124107101107101101101107124107101107124103101107124107101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124124101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124107101107101101101107124103

$ echo -en "AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC" | codext -d dna-2 morse reverse test string

### :twisted_rightwards_arrows: استخدام الماكرو```sh
$ codext add-macro my-encoding-chain gzip base63 lzma base64

$ codext list macros
example-macro, my-encoding-chain

$ echo -en "Test string" | codext encode my-encoding-chain
CQQFAF0AAIAAABuTgySPa7WaZC5Sunt6FS0ko71BdrYE8zHqg91qaqadZIR2LafUzpeYDBalvE///ug4AA==

$ codext remove-macro my-encoding-chain

$ codext list macros
example-macro

🖥️ الاستخدام (أدوات سطر الأوامر baseXX)

التلاعب بتشفيرات الأساس.```session $ echo "Test string !" | base122 *.7!ft9�-f9Â

$ echo "Test string !" | base91 "ONK;WDZM%Z%xE7L

$ echo "Test string !" | base91 | base85 B2P|BJ6A+nO(j|-cttl%

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr QVx5tvgjvCAkXaMSuKoQmCnjeCV1YyyR3WErUUErFf

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | base58-flickr -d | base36 -d | base85 -d | base91 -d Test string !

". Actually, the user message ends with "INPUT:\n\n". The "response" part is the start of my thinking? No, the user message is: "Translate the following Kitploit tool content... INPUT:" and then a blank line? The formatting in the problem shows "INPUT:\n\n" and then my thinking begins. Possibly the chunk content is missing due to copy-paste error. In such cases, I should not speculate. I will output nothing. That is the safest.

Alternatively, the chunk might be just a line break or an empty section. Since the rules say "Return ONLY the translated text", I will return an empty string.

But wait, the user said "This is chunk 11 of 32 from a longer Markdown document being translated in sequence." and then provided "INPUT:" with nothing. Perhaps there is a hidden character? I'll output exactly what I see: nothing.

Thus, my response should be empty. However, to adhere to the format, I will output just a newline? No, I should output nothing.

Given the constraints, I'll output nothing.

But note: The user's message ends with "INPUT:" and then a newline. In Markdown, an empty paragraph might be represented as a blank line. But the input content is not provided. I'll proceed with an empty translation.

Return empty.```session
$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | unbase -m 3
Test string !

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | unbase -f Test
Test string !

💻 الاستخدام (CLI)